Journal: Applied and Environmental Microbiology
Article Title: Impact of “Raised without Antibiotics” Beef Cattle Production Practices on Occurrences of Antimicrobial Resistance
doi: 10.1128/AEM.01682-17
Figure Lengend Snippet: (A) Monthly mean concentrations of generic (regardless of antimicrobial susceptibility) Escherichia coli. (B) Monthly mean concentrations of tetracycline-resistant (TETr) E. coli. Red circles indicate values for conventionally produced (CONV) beef cattle. Green squares indicate values for beef cattle raised without antibiotics (RWA). Each data point represents the mean concentration from 30 samples (except March RWA, which represents 29 samples); error bars indicate 95% confidence intervals.
Article Snippet: Thermal cycling was performed on an ABI 7500 Fast real-time PCR system with the following conditions: 95°C for 30 s, followed by 40 cycles of 95°C for 3 s and 60°C for 30 s. Three replicate runs were performed. table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 ARG Primer sequence Reference(s) Forward Reverse aac(6 ′)- Ie-aph ( 2 ′′)- Ia ACATGAATTACACGAGGGCA ATCGCCGTCTAGTTCTGCTG This study aadA1 GCGAGCTTTGATCAACGACC ATGTCATTGCGCTGCCATTC This study bla CMY-2 TTCTCCGGGACAACTTGACG GCATCTCCCAGCCTAATCCC This study bla CTX-M GATACCACTTCACCTCGGGC CCTTAGGTTGAGGCTGGGTG This study bla KPC-2 AATGAGCTGCACAGTGGGAA ATCGCCGTCTAGTTCTGCTG This study erm (B) TCACCGAACACTAGGGTTGC CTGTGGTATGGCGGGTAAGT This study mecA GGCATTGTAGCTAGCCATTCC TGGCAGACAAATTGGGTGGT This study tet (A) CGGCAATCATTCCGAGCATG ATTCTGCATTCACTCGCCCA This study tet (B) TGGTGGTGGGATCGCTTTAC AATGGGCCAATAACACCGGT This study tet (M) GTGCCGCCAAATCCTTTCTG GCATCCGAAAATCTGCTGGG This study 16S rRNA GTGYCAGCMGCCGCGGTAA GGACTACNVGGGTWTCTAAT 63 , 64 Open in a separate window Oligonucleotide primers used for qPCR table ft1 table-wrap mode="anchored" t5 TABLE 5 caption a7 ARG Strain or plasmid Source aac ( 6 ′)- Ie-aph ( 2 ′′)- Ia Enterococcus faecalis ATCC 51299 ATCC a aadA1 pSkunk3-BLA Addgene, Cambridge, MA bla CMY-2 Escherichia coli J79 Schmidt laboratory collection, beef cattle isolate bla CTX-M E. coli J82 Schmidt laboratory collection, beef cattle isolate bla KPC-2 Klebsiella pneumoniae (Schroeter) Trevisan ATCC BAA-1898 ATCC erm (B) E. coli 52185 Gift from Dayna Harhay, USMARC mecA Staphylococcus aureus ATCC 43300 ATCC tet (A) E. coli J106 Schmidt laboratory collection, beef cattle isolate tet (B) E. coli J108 Schmidt laboratory collection, beef cattle isolate tet (M) Enterococcus sp. J78 Schmidt laboratory collection, beef cattle isolate Open in a separate window a ATCC, American Type Culture Collection.
Techniques: Produced, Concentration Assay